Stem-loop sequence fve-MIR11288d

AccessionMI0036461 (change log)
DescriptionFragaria vesca miR11288d stem-loop
Stem-loop
            ag  cg   c     u         a g     -gg   uu     ag          c           a   --gag   -ca     au 
5' ggggauccg  uc  cug guuuu aaaacggug a aucua   guc  cgauc  caauucguca auuccaguuca acu     cag   gucgg  a
   |||||||||  ||  ||| ||||| ||||||||| | |||||   |||  |||||  |||||||||| ||||||||||| |||     |||   |||||   
3' uccuugggc  ag  gac cagag uuuugcuac u uagau   uag  gcugg  guuaagcggu uaggguuaagu uga     guc   cagcc  u
            ga  ag   a     -         c g     aau   -c     ga          u           c   gagaa   aug     gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 25355853-25356050 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR11288d
fve-MIR11288aLG3: 25352228-25352319 [+]
fve-MIR11288bLG3: 25352641-25352750 [+]
fve-MIR11288cLG3: 25353781-25353886 [+]
fve-MIR11288dLG3: 25355853-25356050 [+]
fve-MIR11288eLG3: 25359226-25359328 [+]
Database links

Mature sequence fve-miR11288d

Accession MIMAT0044600
Sequence

164 - 

uccaucguuuugagacacagg

 - 184

Get sequence
Evidence experimental; Illumina [1]

References

1