Stem-loop sequence esi-MIR3469b

AccessionMI0036547 (change log)
DescriptionEctocarpus siliculosus miR3469b stem-loop
Stem-loop
   cacu                  c               c     --a   gu 
5'     cuccgccucuggggugga augugaacaccgucg caucc   aca  a
       |||||||||||||||||| ||||||||||||||| |||||   |||  c
3'     gaggcggagaccccaccu uacacuuguggcagc guagg   ugu  g
   ---g                  a               a     agc   ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_89: 313918-314019 [-]
intergenic
Clustered miRNAs
< 10kb from esi-MIR3469b
esi-MIR3469bsctg_89: 313918-314019 [-]
esi-MIR3469sctg_89: 313892-314041 [+]
Database links

Mature sequence esi-miR3469b-5p

Accession MIMAT0044652
Sequence

12 - 

ucugggguggacaugugaaca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3469b-3p

Accession MIMAT0044653
Sequence

76 - 

uucacauauccaccccagagg

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26101255 "microRNAs and the evolution of complex multicellularity: identification of a large, diverse complement of microRNAs in the brown alga Ectocarpus" Tarver JE, Cormier A, Pinzon N, Taylor RS, Carre W, Strittmatter M, Seitz H, Coelho SM, Cock JM Nucleic Acids Res. 43:6384-6398(2015).