Stem-loop sequence fhe-bantam

AccessionMI0037100 (change log)
DescriptionFasciola hepatica bantam stem-loop
Literature search

2 open access papers mention fhe-bantam
(4 sentences)

Stem-loop
   --     c uc     ug   u    caaucaccagguuuugccccaaag 
5'   cagcu u  ucgcg  cuc gaga                        g
     ||||| |  |||||  ||| ||||                         
3'   gucga a  agcgc  gag cucu                        u
   ug     a uu     ua   u    cccgauaacggugacggucccggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold2423: 167396-167495 [+]
intergenic
Database links

Mature sequence fhe-bantam

Accession MIMAT0045198
Sequence

79 - 

ugagaucgcgauuaaagcuggu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).