Stem-loop sequence fhe-bantam

Accession

MI0037100 (change log)

Description

Fasciola hepatica bantam stem-loop

Literature search

2 open access papers mention fhe-bantam
(4 sentences)

Stem-loop

   --     c uc     ug   u    caaucaccagguuuugccccaaag 
5'   cagcu u  ucgcg  cuc gaga                        g
     ||||| |  |||||  ||| ||||                         
3'   gucga a  agcgc  gag cucu                        u
   ug     a uu     ua   u    cccgauaacggugacggucccggc 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Fhepatica_v1; GCA_000947175.1): scaffold2423: 167396-167495 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0037100

Mature sequence fhe-bantam

• Accession: MIMAT0045198
• Sequence: 79 - ugagaucgcgauuaaagcuggu - 100
• Evidence: experimental; Illumina [1]

References

1. PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).