Stem-loop sequence fhe-mir-2a

AccessionMI0037107 (change log)
DescriptionFasciola hepatica miR-2a stem-loop
Literature search

1 open access papers mention fhe-mir-2a
(1 sentences)

Stem-loop
   ---ca      a       ga    -c g 
5'      gucaau cuggcug  ggca  c u
        |||||| |||||||  ||||  |  
3'      uaguua gaccgac  cugu  g a
   gcaag      a       -a    cu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold879: 28178-28232 [+]
intergenic
Clustered miRNAs
< 10kb from fhe-mir-2a
fhe-mir-71ascaffold879: 28077-28139 [+]
fhe-mir-2ascaffold879: 28178-28232 [+]
fhe-mir-2bscaffold879: 28276-28327 [+]
fhe-mir-2escaffold879: 28368-28423 [+]
Database links

Mature sequence fhe-miR-2a

Accession MIMAT0045205
Sequence

33 - 

gucacagccagaauugaugaacg

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).