Stem-loop sequence fhe-mir-2c

AccessionMI0037109 (change log)
DescriptionFasciola hepatica miR-2c stem-loop
Literature search

1 open access papers mention fhe-mir-2c
(1 sentences)

Stem-loop
   -c     --c    a       u  cug 
5'   cccuu   cacg cugugau ug   u
     |||||   |||| ||||||| ||    
3'   gggaa   gugc gacacua ac   c
   uc     uuc    c       u  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold278: 636459-636513 [+]
intergenic
Clustered miRNAs
< 10kb from fhe-mir-2c
fhe-mir-71bscaffold278: 635977-636066 [+]
fhe-mir-2fscaffold278: 636130-636246 [+]
fhe-mir-2dscaffold278: 636316-636415 [+]
fhe-mir-2cscaffold278: 636459-636513 [+]
Database links

Mature sequence fhe-miR-2c

Accession MIMAT0045207
Sequence

32 - 

auaucacagccgugcuuaagggcu

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).