Stem-loop sequence fhe-mir-2d

AccessionMI0037110 (change log)
DescriptionFasciola hepatica miR-2d stem-loop
Literature search

1 open access papers mention fhe-mir-2d
(1 sentences)

Stem-loop
   ---auc     -          ccugccagcgugguucgaaggcguguggc 
5'       aguag auugugauac                             u
         ||||| ||||||||||                              
3'       ucguc ugacacuaug                             c
   guggau     c          augaaccgccacggcgucuuuaagaaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold278: 636316-636415 [+]
intergenic
Clustered miRNAs
< 10kb from fhe-mir-2d
fhe-mir-71bscaffold278: 635977-636066 [+]
fhe-mir-2fscaffold278: 636130-636246 [+]
fhe-mir-2dscaffold278: 636316-636415 [+]
fhe-mir-2cscaffold278: 636459-636513 [+]
Database links

Mature sequence fhe-miR-2d

Accession MIMAT0045208
Sequence

79 - 

guaucacaguccugcuuaggug

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).