Stem-loop sequence fhe-mir-2e

AccessionMI0037111 (change log)
DescriptionFasciola hepatica miR-2e stem-loop
Literature search

1 open access papers mention fhe-mir-2e
(7 sentences)

Stem-loop
       --   a     c u     ugcca 
5' ccaa  cuu gacug g uauac     u
   ||||  ||| ||||| | |||||      
3' gguu  gaa cugac c augug     u
       uc   c     a u     cucug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold879: 28368-28423 [+]
intergenic
Clustered miRNAs
< 10kb from fhe-mir-2e
fhe-mir-71ascaffold879: 28077-28139 [+]
fhe-mir-2ascaffold879: 28178-28232 [+]
fhe-mir-2bscaffold879: 28276-28327 [+]
fhe-mir-2escaffold879: 28368-28423 [+]
Database links

Mature sequence fhe-miR-2e

Accession MIMAT0045209
Sequence

36 - 

guaucacaguccaagcuuugg

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).