Stem-loop sequence fhe-mir-2f

AccessionMI0037112 (change log)
DescriptionFasciola hepatica miR-2f stem-loop
Literature search

1 open access papers mention fhe-mir-2f
(1 sentences)

Stem-loop
   a         uc      g     cg    aacggguccacagcggaucaacacggcu 
5'  gguaucgau  uggcug gauag  aaga                            u
    |||||||||  |||||| |||||  ||||                             
3'  ccguaguua  accgac cuguc  uucu                            g
   -         ua      a     ca    gccaccguuuggcgcgacccuugccacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold278: 636130-636246 [+]
intergenic
Clustered miRNAs
< 10kb from fhe-mir-2f
fhe-mir-71bscaffold278: 635977-636066 [+]
fhe-mir-2fscaffold278: 636130-636246 [+]
fhe-mir-2dscaffold278: 636316-636415 [+]
fhe-mir-2cscaffold278: 636459-636513 [+]
Database links

Mature sequence fhe-miR-2f

Accession MIMAT0045210
Sequence

97 - 

gucacagccaauauugaugcc

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).