Stem-loop sequence fhe-mir-10

AccessionMI0037115 (change log)
DescriptionFasciola hepatica miR-10 stem-loop
Literature search

1 open access papers mention fhe-mir-10
(2 sentences)

Stem-loop
   -aa  c       c        c  g   
5'    cc uguagac cgaguuug au ca 
      || ||||||| |||||||| || | c
3'    gg acaucug gcuuaaac ua gu 
   caa  a       a        u  g   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold95: 429336-429391 [+]
intergenic
Database links

Mature sequence fhe-miR-10

Accession MIMAT0045213
Sequence

1 - 

aacccuguagacccgaguuugca

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).