Stem-loop sequence fhe-mir-71b

AccessionMI0037121 (change log)
DescriptionFasciola hepatica miR-71b stem-loop
Literature search

2 open access papers mention fhe-mir-71b
(3 sentences)

Stem-loop
   --u        u a   g    ac  au     uu    uca     u 
5'    gaaagacu g gua ugag  gc  gccgg  accg   ugugg c
      |||||||| | ||| ||||  ||  |||||  ||||   ||||| a
3'    cuuucuga c cau acuc  cg  cggcc  uggc   auacc a
   gug        c -   -    --  --     -c    uuc     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold278: 635977-636066 [+]
intergenic
Clustered miRNAs
< 10kb from fhe-mir-71b
fhe-mir-71bscaffold278: 635977-636066 [+]
fhe-mir-2fscaffold278: 636130-636246 [+]
fhe-mir-2dscaffold278: 636316-636415 [+]
fhe-mir-2cscaffold278: 636459-636513 [+]
Database links

Mature sequence fhe-miR-71b

Accession MIMAT0045219
Sequence

1 - 

ugaaagacuugaguagugag

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).