Stem-loop sequence fhe-mir-124

AccessionMI0037124 (change log)
DescriptionFasciola hepatica miR-124 stem-loop
Literature search

1 open access papers mention fhe-mir-124
(2 sentences)

Stem-loop
   --      u     gua        --   c  a 
5'   gcauuu ccgug   gccuugau  cug uc u
     |||||| |||||   ||||||||  ||| || a
3'   uguaag ggcgc   cggaauua  gac ag c
   ac      u     --a        cg   -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold3329: 101586-101649 [-]
intergenic
Database links

Mature sequence fhe-miR-124

Accession MIMAT0045222
Sequence

43 - 

uuaaggcacgcggugaauguca

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).