Stem-loop sequence fhe-let-7

AccessionMI0037130 (change log)
DescriptionFasciola hepatica let-7 stem-loop
Literature search

2 open access papers mention fhe-let-7
(6 sentences)

Stem-loop 
   auuc     -          ----cucauaug    -u  -         ug cg 
5'     ggcga gagguaguga            acuu  ac caauugucu  g  a
       ||||| ||||||||||            ||||  || |||||||||  |   
3'     cuguu cuccaucgcu            ugaa  ug guugacaga  c  a
   --gu     g          cauuuucucuca    uc  u         gu ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Fhepatica_v1; GCA_000947175.1) Overlapping transcripts
scaffold112: 524162-524264 [+]
intergenic
Database links

Mature sequence fhe-let-7

Accession MIMAT0045228
Sequence

8 -  

gagagguagugacucauaugacu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26432296 "The miRnome of Fasciola hepatica juveniles endorses the existence of a reduced set of highly divergent micro RNAs in parasitic flatworms" Fontenla S, Dell'Oca N, Smircich P, Tort JF, Siles-Lucas M Int J Parasitol. 45:901-913(2015).