Stem-loop sequence tca-mir-276b

AccessionMI0037445 (change log)
DescriptionTribolium castaneum miR-276b stem-loop
Stem-loop
   ----   ac      a         agccga 
5'     agc  gguaug aguuccuac      a
       |||  |||||| |||||||||       
3'     ucg  ccauau ucaaggaug      a
   guga   cu      c         cacuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tcas4.0) Overlapping transcripts
ChLG3: 12023440-12023499 [+]
intergenic
Clustered miRNAs
< 10kb from tca-mir-276b
tca-mir-276ChLG3: 12023434-12023504 [-]
tca-mir-276bChLG3: 12023440-12023499 [+]
Database links

Mature sequence tca-miR-276b-5p

Accession MIMAT0045604
Sequence

1 - 

agcacgguaugaaguuccua

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence tca-miR-276b-3p

Accession MIMAT0045605
Sequence

37 - 

uaggaacucuauaccucgcu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26518483 "MicroRNA evolution, expression, and function during short germband development in Tribolium castaneum" Ninova M, Ronshaugen M, Griffiths-Jones S Genome Res. 26:85-96(2016).