Stem-loop sequence aae-mir-11893-2

AccessionMI0037926 (change log)
DescriptionAedes aegypti miR-11893-2 stem-loop
Stem-loop
   au       ag    a    a    --  uu 
5'   gguaagu  auaa ucag aaga  cg  u
     |||||||  |||| |||| ||||  ||  u
3'   ccauucg  uauu aguc uucu  gc  u
   cu       ca    c    c    uu  ua 
Get sequence
Deep sequencing
6377 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.154: 394984-395046 [+]
intergenic
Database links

Mature sequence aae-miR-11893

Accession MIMAT0045989
Sequence

41 - 

uuccugacuuauacgcuuaccu

 - 62

Get sequence
Deep sequencing12328 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).