Stem-loop sequence aae-mir-11894a-3

AccessionMI0037929 (change log)
DescriptionAedes aegypti miR-11894a-3 stem-loop
Stem-loop
          ug                 g  uca 
5' gaugggu  ucuugaaaugguaaaga ug   a
   |||||||  ||||||||||||||||| ||    
3' uuaucca  agaacuuuaccauuucu ac   c
          gu                 -  uac 
Get sequence
Deep sequencing
19458 reads, 850 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.210: 626320-626384 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-11894a-3
aae-mir-11894b-2supercont1.210: 627560-627624 [-]
aae-mir-11894a-3supercont1.210: 626320-626384 [-]
Database links

Mature sequence aae-miR-11894a

Accession MIMAT0045990
Sequence

42 - 

uuuaccauuucaagaugaccua

 - 63

Get sequence
Deep sequencing58056 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).