Stem-loop sequence aae-mir-11894b-2

AccessionMI0037931 (change log)
DescriptionAedes aegypti miR-11894b-2 stem-loop
Stem-loop
                             --   u 
5' gaugggucguauugaaaugguaaaga  gug c
   ||||||||||||||||||||||||||  ||| a
3' uuauccaguauaacuuuaccauuucu  uac a
                             ac   u 
Get sequence
Deep sequencing
19192 reads, 850 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.210: 627560-627624 [-]
intergenic
Clustered miRNAs
< 10kb from aae-mir-11894b-2
aae-mir-11894b-2supercont1.210: 627560-627624 [-]
aae-mir-11894a-3supercont1.210: 626320-626384 [-]
Database links

Mature sequence aae-miR-11894b

Accession MIMAT0045991
Sequence

42 - 

uuuaccauuucaauaugaccua

 - 63

Get sequence
Deep sequencing38180 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).