Stem-loop sequence aae-mir-10365

AccessionMI0037934 (change log)
DescriptionAedes aegypti miR-10365 stem-loop
Stem-loop
       auu           u  g       acaucaa  guu 
5' gacc   agaauguggaa cu uuuuugu       gu   a
   ||||   ||||||||||| || |||||||       ||    
3' cugg   ucuuauacuuu ga aaaaacg       ca   c
       cgu           u  -       ----aag  aag 
Get sequence
Deep sequencing
256 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.620: 576225-576303 [-]
intergenic
Database links

Mature sequence aae-miR-10365

Accession MIMAT0045993
Sequence

5 - 

auuagaauguggaaucuguuuu

 - 26

Get sequence
Deep sequencing158 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).