Stem-loop sequence aae-mir-11897b

AccessionMI0037938 (change log)
DescriptionAedes aegypti miR-11897b stem-loop
Stem-loop
                  g            u 
5' augcuacagaaucga gcuuacuaugau u
   ||||||||||||||| |||||||||||| c
3' uacgauguuuuaguu cgaaugauacua c
                  a            a 
Get sequence
Deep sequencing
201 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.32: 2433926-2433986 [-]
intergenic
Database links

Mature sequence aae-miR-11897b

Accession MIMAT0045997
Sequence

38 - 

uaguaagcauugauuuuguagc

 - 59

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).