Stem-loop sequence aae-mir-11901

AccessionMI0037942 (change log)
DescriptionAedes aegypti miR-11901 stem-loop
Stem-loop
       auc                ug   ag 
5' aaac   acagaauuguuuuuac  aua  g
   ||||   ||||||||||||||||  |||   
3' uuug   ugucuuaauaaaaaug  uau  a
       aaa                ug   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.885: 342918-342979 [+]
intergenic
Database links

Mature sequence aae-miR-11901

Accession MIMAT0046000
Sequence

4 - 

caucacagaauuguuuuuacug

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).