Stem-loop sequence aae-mir-11902

AccessionMI0037943 (change log)
DescriptionAedes aegypti miR-11902 stem-loop
Stem-loop
   agggcgugacgccaucuacaa     a   g 
5'                      ggagu ucu u
                        ||||| ||| u
3'                      cuuca aga c
   ---cuucggcuugcgaagcaa     -   a 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.71: 1610978-1611038 [+]
intergenic
Database links

Mature sequence aae-miR-11902

Accession MIMAT0046001
Sequence

38 - 

aacuucaacgaagcguucggcuu

 - 60

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).