Stem-loop sequence aae-mir-11918

AccessionMI0037964 (change log)
DescriptionAedes aegypti miR-11918 stem-loop
Stem-loop
   uauaa   c        cc        c    gu 
5'      guc cgucgucg  uucaugug ggug  c
        ||| ||||||||  |||||||| ||||   
3'      cag gcagcagc  aaguacac ccgu  a
   cgccg   u        --        a    ac 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.151: 1291074-1291141 [-]
intergenic
Database links

Mature sequence aae-miR-11918

Accession MIMAT0046018
Sequence

46 - 

caugaacgacgacgugacgccg

 - 67

Get sequence
Deep sequencing54 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).