Stem-loop sequence aae-mir-11920-1

AccessionMI0037966 (change log)
DescriptionAedes aegypti miR-11920-1 stem-loop
Literature search

1 open access papers mention aae-mir-11920-1
(3 sentences)

Stem-loop
   uccc       c  -     c      a gcu 
5'     ccaucaa ug cugaa uguuuu g   u
       ||||||| || ||||| |||||| |    
3'     ggugguu ac gacuu acgaaa c   c
   agca       -  a     u      g aug 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.16: 2615844-2615907 [+]
intergenic
Database links

Mature sequence aae-miR-11920

Accession MIMAT0046020
Sequence

4 - 

cccaucaacugcugaacuguuuu

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).