Stem-loop sequence aae-mir-11921

AccessionMI0037970 (change log)
DescriptionAedes aegypti miR-11921 stem-loop
Stem-loop
       u        a    a    auucu    a 
5' ccau cucgcaua cagu ccau     uggg u
   |||| |||||||| |||| ||||     ||||  
3' ggua gagcguau guca ggua     acuc u
       u        a    g    aauau    u 
Get sequence
Deep sequencing
1054 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.339: 1278976-1279043 [+]
intergenic
Database links

Mature sequence aae-miR-11921

Accession MIMAT0046021
Sequence

44 - 

aaaugggacugauaugcgaguau

 - 66

Get sequence
Deep sequencing1041 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:26914027 "Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs" Miesen P, Ivens A, Buck AH, van Rij RP PLoS Negl Trop Dis. 10:e0004452(2016).