Stem-loop sequence pte-iab-4-1

AccessionMI0038010 (change log)
DescriptionParasteatoda tepidariorum iab-4-1 stem-loop
Literature search

1 open access papers mention pte-iab-4-1
(1 sentences)

Stem-loop
   ---u           u    -  u  uaaua 
5'     cguauacugaa guau cc ga     a
       ||||||||||| |||| || ||     u
3'     gcauaugacuu caua gg cu     u
   caau           c    u  c  cucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_497: 896331-896391 [-]
intergenic
Clustered miRNAs
< 10kb from pte-iab-4-1
pte-iab-8-1Scf5bK3_497: 896333-896393 [+]
pte-iab-4-1Scf5bK3_497: 896331-896391 [-]
Database links

Mature sequence pte-iab-4-5p

Accession MIMAT0046077
Sequence

1 - 

ucguauacugaauguauccuga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-iab-4-3p

Accession MIMAT0046078
Sequence

38 - 

cgguauaccuucaguauacguaac

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).