Stem-loop sequence pte-iab-4-2

AccessionMI0038011 (change log)
DescriptionParasteatoda tepidariorum iab-4-2 stem-loop
Literature search

1 open access papers mention pte-iab-4-2
(1 sentences)

Stem-loop
   ---u           u    -  u   uuu 
5'     cguauacugaa guau cc gag   a
       ||||||||||| |||| || |||    
3'     gcauaugacuu caua gg cuu   a
   cgau           c    u  c   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_833: 1315213-1315270 [-]
intergenic
Clustered miRNAs
< 10kb from pte-iab-4-2
pte-iab-8-2Scf5bK3_833: 1315215-1315272 [+]
pte-iab-4-2Scf5bK3_833: 1315213-1315270 [-]
Database links

Mature sequence pte-iab-4-5p

Accession MIMAT0046077
Sequence

1 - 

ucguauacugaauguauccuga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-iab-4-2-3p

Accession MIMAT0046079
Sequence

35 - 

cgguauaccuucaguauacguagc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).