Stem-loop sequence pte-let-7

AccessionMI0038014 (change log)
DescriptionParasteatoda tepidariorum let-7 stem-loop
Literature search

1 open access papers mention pte-let-7
(4 sentences)

Stem-loop
   -u     -                 a aa uacac 
5'   gaggu aguagguuguauaguuu g  c     c
     ||||| ||||||||||||||||| |  |      
3'   uuuca ucguucgacauaucaag c  g     u
   cc     a                 - gg uaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_446: 4924728-4924796 [+]
intergenic
Database links

Mature sequence pte-let-7-5p

Accession MIMAT0046082
Sequence

1 - 

ugagguaguagguuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-let-7-3p

Accession MIMAT0046083
Sequence

48 - 

cuauacagcuugcuaacuuucc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).