Stem-loop sequence pte-mir-1

AccessionMI0038015 (change log)
DescriptionParasteatoda tepidariorum miR-1 stem-loop
Stem-loop
   --         c    uuc      -c   u 
5'   ccgugcuuc uuac   ccauau  uuc u
     ||||||||| ||||   ||||||  ||| a
3'   gguaugaag aaug   gguaug  gag a
   ga         a    uaa      cu   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_269: 5291341-5291402 [+]
intergenic
Database links

Mature sequence pte-miR-1-5p

Accession MIMAT0046084
Sequence

1 - 

ccgugcuuccuuacuucccaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-1-3p

Accession MIMAT0046085
Sequence

41 - 

uggaauguaaagaaguauggag

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).