Stem-loop sequence pte-mir-10

AccessionMI0038016 (change log)
DescriptionParasteatoda tepidariorum miR-10 stem-loop
Literature search

2 open access papers mention pte-mir-10
(4 sentences)

Stem-loop
   -u   -  g    u          --g  a 
5'   acc cu uaga ccgaauuugu   gc a
     ||| || |||| ||||||||||   || a
3'   ugg ga aucu ggcuuaaaca   cg a
   cu   a  g    u          aua  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_497: 2682407-2682465 [+]
intergenic
Database links

Mature sequence pte-miR-10-5p

Accession MIMAT0046086
Sequence

1 - 

uacccuguagauccgaauuugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-10-3p

Accession MIMAT0046087
Sequence

37 - 

caaauucgguucuagagagguuc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).