Stem-loop sequence pte-mir-100a

AccessionMI0038017 (change log)
DescriptionParasteatoda tepidariorum miR-100a stem-loop
Literature search

1 open access papers mention pte-mir-100a
(5 sentences)

Stem-loop
   --u         uc         ---    a 
5'    acccguaga  cgaacuugu   guuc c
      |||||||||  |||||||||   ||||  
3'    ugggcauuu  guuugaaca   caag u
   agu         ua         ccu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_446: 4913478-4913536 [+]
intergenic
Database links

Mature sequence pte-miR-100a-5p

Accession MIMAT0046088
Sequence

1 - 

uacccguagauccgaacuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-100a-3p

Accession MIMAT0046089
Sequence

38 - 

caaguuugauuuuacggguuga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).