Stem-loop sequence pte-mir-100b

AccessionMI0038018 (change log)
DescriptionParasteatoda tepidariorum miR-100b stem-loop
Literature search

1 open access papers mention pte-mir-100b
(5 sentences)

Stem-loop
   -a         uc   a      uccuuug 
5'   acccguaga  cga cuugug       u
     |||||||||  ||| ||||||        
3'   ugggcaucu  gcu gaacac       a
   uc         cc   c      ccuccag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_97: 8286326-8286386 [+]
intergenic
Database links

Mature sequence pte-miR-100b-5p

Accession MIMAT0046090
Sequence

1 - 

aacccguagauccgaacuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-100b-3p

Accession MIMAT0046091
Sequence

40 - 

acaagcucgccucuacgggucu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).