Stem-loop sequence pte-mir-125b

AccessionMI0038020 (change log)
DescriptionParasteatoda tepidariorum miR-125b stem-loop
Literature search

1 open access papers mention pte-mir-125b
(4 sentences)

Stem-loop
   uc        c          a    uuc 
5'   ccugagac cuaacuugug ugga   a
     |||||||| |||||||||| ||||    
3'   gggcucug gauugaacac gcuu   u
   cc        u          -    cgu 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_97: 8375232-8375290 [+]
intergenic
Database links

Mature sequence pte-miR-125b-5p

Accession MIMAT0046094
Sequence

1 - 

ucccugagacccuaacuugug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-125b-3p

Accession MIMAT0046095
Sequence

41 - 

caaguuagugucucgggcc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).