Stem-loop sequence pte-mir-190

AccessionMI0038023 (change log)
DescriptionParasteatoda tepidariorum miR-190 stem-loop
Stem-loop
   --ag           au         ugu a 
5'     auauguuugau  ucuugguug   c a
       |||||||||||  |||||||||   | u
3'     uauacagacua  agaaccaac   g u
   ggua           --         -uu u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_485: 4297126-4297185 [-]
intergenic
Database links

Mature sequence pte-miR-190-5p

Accession MIMAT0046099
Sequence

1 - 

agauauguuugauauucuugguug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-190-3p

Accession MIMAT0046100
Sequence

39 - 

accaagaaucagacauauaugg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).