Stem-loop sequence pte-mir-193a

AccessionMI0038024 (change log)
DescriptionParasteatoda tepidariorum miR-193a stem-loop
Stem-loop
   --           u  a  ga     ugacuu 
5'   cgggauuuagc gg cu  uggac      c
     ||||||||||| || ||  |||||       
3'   gcccugaauug cc gg  aucug      a
   ga           u  -  uc     uuaaag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_535: 370440-370502 [+]
intergenic
Database links

Mature sequence pte-miR-193a-5p

Accession MIMAT0046101
Sequence

1 - 

cgggauuuagcuggacugaugga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-193a-3p

Accession MIMAT0046102
Sequence

42 - 

uacuggccuguuaagucccgag

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).