Stem-loop sequence pte-mir-193b

AccessionMI0038025 (change log)
DescriptionParasteatoda tepidariorum miR-193b stem-loop
Literature search

1 open access papers mention pte-mir-193b
(2 sentences)

Stem-loop
   ua    u    a   aa   ac    u 
5'   uggg cuug cag  cag  gauu u
     |||| |||| |||  |||  ||||  
3'   accc gaau guc  guc  cuaa a
   ac    u    c   cg   au    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_1700: 847059-847114 [-]
intergenic
Database links

Mature sequence pte-miR-193b-5p

Accession MIMAT0046103
Sequence

1 - 

uaugggucuugacagaacagac

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-193b-3p

Accession MIMAT0046104
Sequence

35 - 

uacuggccugcuaagucccaca

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).