Stem-loop sequence pte-mir-210

AccessionMI0038026 (change log)
DescriptionParasteatoda tepidariorum miR-210 stem-loop
Stem-loop
   --        g -    u   u   c  ga 
5'   agcugcug c cacg cac aga uc  u
     |||||||| | |||| ||| ||| ||  u
3'   ucggcgac g gugc gug ucu ag  u
   ua        a u    -   u   -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_925: 2240834-2240891 [+]
intergenic
Database links

Mature sequence pte-miR-210-5p

Accession MIMAT0046105
Sequence

1 - 

agcugcuggccacgucacuaga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-210-3p

Accession MIMAT0046106
Sequence

37 - 

uugugcgugugacagcggcuau

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).