Stem-loop sequence pte-mir-263a

AccessionMI0038027 (change log)
DescriptionParasteatoda tepidariorum miR-263a stem-loop
Stem-loop
   --c         u          a   gga 
5'    uuggcacug aagaauucac gau   u
      ||||||||| |||||||||| |||   a
3'    aaucguggu uucuuaggug cua   u
   aga         -          -   aac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_537.1: 22595157-22595215 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-263a
pte-mir-263aScf5bK3_537.1: 22595157-22595215 [+]
pte-mir-96Scf5bK3_537.1: 22595291-22595350 [+]
Database links

Mature sequence pte-miR-263a-5p

Accession MIMAT0046107
Sequence

1 - 

cuuggcacuguaagaauucacaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-263a-3p

Accession MIMAT0046108
Sequence

38 - 

guggauucuuuggugcuaaaga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).