Stem-loop sequence pte-mir-276-1

AccessionMI0038030 (change log)
DescriptionParasteatoda tepidariorum miR-276-1 stem-loop
Literature search

1 open access papers mention pte-mir-276-1
(2 sentences)

Stem-loop
   --    a                 -----  g 
5'   agcg gguauggaguucuuacu     gu a
     |||| |||||||||||||||||     ||  
3'   ucgu ccauacuucaaggaugg     cg a
   gc    a                 uuaga  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_66.1: 428527-428585 [-]
intergenic
Database links

Mature sequence pte-miR-276-5p

Accession MIMAT0046113
Sequence

1 - 

agcgagguauggaguucuuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-276-3p

Accession MIMAT0046114
Sequence

38 - 

uaggaacuucauaccaugcucg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).