Stem-loop sequence pte-mir-276-2

AccessionMI0038031 (change log)
DescriptionParasteatoda tepidariorum miR-276-2 stem-loop
Stem-loop
   --    a             ----      u 
5'   agcg gguaugaaguucu    uacugu u
     |||| |||||||||||||    |||||| c
3'   ucgu ccauacuucaagg    augaca a
   gc    a             augg      u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_1129.1: 682519-682577 [+]
intergenic
Database links

Mature sequence pte-miR-276-2-5p

Accession MIMAT0046115
Sequence

1 - 

agcgagguaugaaguucuuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-276-3p

Accession MIMAT0046114
Sequence

38 - 

uaggaacuucauaccaugcucg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).