Stem-loop sequence pte-mir-278b

AccessionMI0038035 (change log)
DescriptionParasteatoda tepidariorum miR-278b stem-loop
Stem-loop
   --c    a      u      uua   guucua 
5'    cgga gagaau cccacc   acc      u
      |||| |||||| ||||||   |||       
3'    gccu cuuuua gggugg   ugg      a
   ucu    g      -      --c   aaaacg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_214: 1515459-1515521 [-]
intergenic
Database links

Mature sequence pte-miR-278b-5p

Accession MIMAT0046122
Sequence

1 - 

ccggaagagaauucccaccuuaacc

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-278b-3p

Accession MIMAT0046123
Sequence

42 - 

ucggugggauuuucguccgucu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).