Stem-loop sequence pte-mir-35a

AccessionMI0038036 (change log)
DescriptionParasteatoda tepidariorum miR-35a stem-loop
Stem-loop
   --g              --      uuua 
5'    caaguuuuucaccu  ugguua    u
      ||||||||||||||  ||||||    a
3'    guuuaaaagguggg  acuaau    u
   cga              cc      uguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_786: 6401680-6401736 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-35a
pte-mir-35zScf5bK3_786: 6406386-6406445 [-]
pte-mir-35iScf5bK3_786: 6405550-6405606 [-]
pte-mir-35fScf5bK3_786: 6405166-6405222 [-]
pte-mir-11950Scf5bK3_786: 6403352-6403408 [-]
pte-mir-35cScf5bK3_786: 6403218-6403274 [-]
pte-mir-35hScf5bK3_786: 6403027-6403083 [-]
pte-mir-35gScf5bK3_786: 6402613-6402671 [-]
pte-mir-35dScf5bK3_786: 6402310-6402366 [-]
pte-mir-35aScf5bK3_786: 6401680-6401736 [-]
pte-mir-35bScf5bK3_786: 6400546-6400602 [-]
Database links

Mature sequence pte-miR-35a-5p

Accession MIMAT0046124
Sequence

1 - 

gcaaguuuuucaccuugguuauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-35a-3p

Accession MIMAT0046125
Sequence

36 - 

ucaccggguggaaaauuugagc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).