Stem-loop sequence pte-mir-279

AccessionMI0038037 (change log)
DescriptionParasteatoda tepidariorum miR-279 stem-loop
Literature search

1 open access papers mention pte-mir-279
(1 sentences)

Stem-loop
   --        -      u    c  uaucua 
5'   ggugagug ggauuu aguc ug      a
     |||||||| |||||| |||| ||      a
3'   cuacucac ccuaga ucag ac      a
   ac        a      -    u  uaucac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_238.1: 754887-754947 [-]
intergenic
Scf5bK3_238.1: 780258-780318 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-279
pte-mir-279Scf5bK3_238.1: 780258-780318 [-]
pte-mir-279Scf5bK3_238.1: 754887-754947 [-]
pte-mir-35sScf5bK3_238.1: 746981-747041 [-]
Database links

Mature sequence pte-miR-279-5p

Accession MIMAT0046126
Sequence

1 - 

ggugagugggauuuuaguccug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-279-3p

Accession MIMAT0046127
Sequence

40 - 

ugacuagauccacacucaucca

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).