Stem-loop sequence pte-mir-281

AccessionMI0038039 (change log)
DescriptionParasteatoda tepidariorum miR-281 stem-loop
Literature search

1 open access papers mention pte-mir-281
(1 sentences)

Stem-loop
   --        -ua      g     gauagu 
5'   aagagagc   uccgug acagu      u
     ||||||||   |||||| |||||       
3'   uucucucg   agguac uguca      g
   au        uua      -     auagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_34: 222859-222918 [+]
intergenic
Database links

Mature sequence pte-miR-281-5p

Accession MIMAT0046130
Sequence

1 - 

aagagagcuauccguggacagu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-281-3p

Accession MIMAT0046131
Sequence

39 - 

ugucauggaauugcucucuuua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).