Stem-loop sequence pte-mir-2a

AccessionMI0038042 (change log)
DescriptionParasteatoda tepidariorum miR-2a stem-loop
Literature search

2 open access papers mention pte-mir-2a
(17 sentences)

Stem-loop
   --   -      ug     u     -u        
5'   cuc ucaagg  gcugu auaug  guguuga 
     ||| ||||||  ||||| |||||  |||||| a
3'   gag aguuuc  cgaca uauac  uauaaua 
   gu   u      gu     c     uu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_595: 726238-726302 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2a
pte-mir-71-2Scf5bK3_595: 731101-731161 [-]
pte-mir-2fScf5bK3_595: 730975-731038 [-]
pte-mir-2aScf5bK3_595: 726238-726302 [-]
pte-mir-2b-1Scf5bK3_595: 726122-726186 [-]
Database links

Mature sequence pte-miR-2a-5p

Accession MIMAT0046136
Sequence

1 - 

cucucaagguggcuguuauaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2a-3p

Accession MIMAT0046137
Sequence

43 - 

uaucacagcugcuuugaugagug

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).