Stem-loop sequence pte-mir-2b-1

AccessionMI0038043 (change log)
DescriptionParasteatoda tepidariorum miR-2b-1 stem-loop
Literature search

2 open access papers mention pte-mir-2b-1
(19 sentences)

Stem-loop
   -   -       -         c   uua   au 
5'  guu gucaaag uggcuguga aug   gag  u
    ||| ||||||| ||||||||| |||   |||  u
3'  cga uaguuuc accgacacu uac   uuc  a
   g   g       g         a   ---   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_595: 726122-726186 [-]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2b-1
pte-mir-71-2Scf5bK3_595: 731101-731161 [-]
pte-mir-2fScf5bK3_595: 730975-731038 [-]
pte-mir-2aScf5bK3_595: 726238-726302 [-]
pte-mir-2b-1Scf5bK3_595: 726122-726186 [-]
Database links

Mature sequence pte-miR-2b-5p

Accession MIMAT0046138
Sequence

1 - 

guugucaaaguggcugugacaug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2b-3p

Accession MIMAT0046139
Sequence

42 - 

uaucacagccagcuuugaugagcg

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).