Stem-loop sequence pte-mir-2c

AccessionMI0038045 (change log)
DescriptionParasteatoda tepidariorum miR-2c stem-loop
Literature search

2 open access papers mention pte-mir-2c
(17 sentences)

Stem-loop
   --       au    a     c  uua a 
5'   ucaucaa  uggc gugau ug   c u
     |||||||  |||| ||||| ||   |  
3'   aguaguu  accg cacua ac   g u
   cu       cu    a     u  uaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_5995: 356792-356849 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2c
pte-mir-71-1Scf5bK3_5995: 356520-356577 [+]
pte-mir-2eScf5bK3_5995: 356661-356719 [+]
pte-mir-2cScf5bK3_5995: 356792-356849 [+]
pte-mir-2b-2Scf5bK3_5995: 359128-359188 [+]
pte-mir-2g-2Scf5bK3_5995: 359230-359289 [+]
pte-mir-2g-1Scf5bK3_5995: 359336-359391 [+]
pte-mir-2dScf5bK3_5995: 359448-359508 [+]
Database links

Mature sequence pte-miR-2c-5p

Accession MIMAT0046141
Sequence

1 - 

ucaucaaauuggcagugaucug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2c-3p

Accession MIMAT0046142
Sequence

37 - 

uaucacagccaucuugaugauc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).