Stem-loop sequence pte-mir-2d

AccessionMI0038046 (change log)
DescriptionParasteatoda tepidariorum miR-2d stem-loop
Stem-loop
   --gg      -   au           uaaau 
5'     gucaaa cug  gcugugaugug     u
       |||||| |||  |||||||||||      
3'     uaguuu gac  cgacacuauac     c
   cgag      c   --           uacuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_5995: 359448-359508 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2d
pte-mir-71-1Scf5bK3_5995: 356520-356577 [+]
pte-mir-2eScf5bK3_5995: 356661-356719 [+]
pte-mir-2cScf5bK3_5995: 356792-356849 [+]
pte-mir-2b-2Scf5bK3_5995: 359128-359188 [+]
pte-mir-2g-2Scf5bK3_5995: 359230-359289 [+]
pte-mir-2g-1Scf5bK3_5995: 359336-359391 [+]
pte-mir-2dScf5bK3_5995: 359448-359508 [+]
Database links

Mature sequence pte-miR-2d-5p

Accession MIMAT0046143
Sequence

1 - 

gggucaaacugaugcugugaugug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2d-3p

Accession MIMAT0046144
Sequence

39 - 

uaucacagccagcuuugaugagc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).