Stem-loop sequence pte-mir-2e

AccessionMI0038047 (change log)
DescriptionParasteatoda tepidariorum miR-2e stem-loop
Literature search

2 open access papers mention pte-mir-2e
(17 sentences)

Stem-loop
   --         -         a   -  uu 
5'   acgucgaag uggcuguga aug ua  c
     ||||||||| ||||||||| ||| ||  a
3'   ugcaguuuc aucgacacu uac au  c
   ug         u         a   c  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_5995: 356661-356719 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2e
pte-mir-71-1Scf5bK3_5995: 356520-356577 [+]
pte-mir-2eScf5bK3_5995: 356661-356719 [+]
pte-mir-2cScf5bK3_5995: 356792-356849 [+]
pte-mir-2b-2Scf5bK3_5995: 359128-359188 [+]
pte-mir-2g-2Scf5bK3_5995: 359230-359289 [+]
pte-mir-2g-1Scf5bK3_5995: 359336-359391 [+]
pte-mir-2dScf5bK3_5995: 359448-359508 [+]
Database links

Mature sequence pte-miR-2e-5p

Accession MIMAT0046145
Sequence

1 - 

acgucgaaguggcugugaaaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2e-3p

Accession MIMAT0046146
Sequence

37 - 

uaucacagcuaucuuugacgugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).