Stem-loop sequence pte-mir-2g-1

AccessionMI0038049 (change log)
DescriptionParasteatoda tepidariorum miR-2g-1 stem-loop
Literature search

2 open access papers mention pte-mir-2g-1
(17 sentences)

Stem-loop
   -------aaa   au           -   au 
5'           cug  gcugugaugug uaa  u
             |||  ||||||||||| |||   
3'           gac  cgacacuauac auu  c
   gaguaguuuc   --           u   aa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_5995: 359336-359391 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2g-1
pte-mir-71-1Scf5bK3_5995: 356520-356577 [+]
pte-mir-2eScf5bK3_5995: 356661-356719 [+]
pte-mir-2cScf5bK3_5995: 356792-356849 [+]
pte-mir-2b-2Scf5bK3_5995: 359128-359188 [+]
pte-mir-2g-2Scf5bK3_5995: 359230-359289 [+]
pte-mir-2g-1Scf5bK3_5995: 359336-359391 [+]
pte-mir-2dScf5bK3_5995: 359448-359508 [+]
Database links

Mature sequence pte-miR-2g-5p

Accession MIMAT0046149
Sequence

1 - 

aaacugaugcugugaugug

 - 19

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2g-3p

Accession MIMAT0046150
Sequence

35 - 

uaucacagccagcuuugaugag

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).