Stem-loop sequence pte-mir-2g-2

AccessionMI0038050 (change log)
DescriptionParasteatoda tepidariorum miR-2g-2 stem-loop
Literature search

2 open access papers mention pte-mir-2g-2
(17 sentences)

Stem-loop
   --uug    -   aua          uaaau 
5'      caaa cug   cugugaugug     u
        |||| |||   ||||||||||     c
3'      guuu gac   gacacuauac     a
   gagua    c   --c          uauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_5995: 359230-359289 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-2g-2
pte-mir-71-1Scf5bK3_5995: 356520-356577 [+]
pte-mir-2eScf5bK3_5995: 356661-356719 [+]
pte-mir-2cScf5bK3_5995: 356792-356849 [+]
pte-mir-2b-2Scf5bK3_5995: 359128-359188 [+]
pte-mir-2g-2Scf5bK3_5995: 359230-359289 [+]
pte-mir-2g-1Scf5bK3_5995: 359336-359391 [+]
pte-mir-2dScf5bK3_5995: 359448-359508 [+]
Database links

Mature sequence pte-miR-2g-2-5p

Accession MIMAT0046151
Sequence

1 - 

uugcaaacugauacugugaugug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-2g-3p

Accession MIMAT0046150
Sequence

39 - 

uaucacagccagcuuugaugag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).