Stem-loop sequence pte-mir-305

AccessionMI0038052 (change log)
DescriptionParasteatoda tepidariorum miR-305 stem-loop
Literature search

1 open access papers mention pte-mir-305
(1 sentences)

Stem-loop
   --          a        u    u  aa 
5'   uuuguacuuc uuaggugc cugg gu  a
     |||||||||| |||||||| |||| ||  c
3'   aaacgugagg aaucuacg gacc ua  g
   gu          g        -    u  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
Scf5bK3_1778: 111273-111334 [+]
intergenic
Clustered miRNAs
< 10kb from pte-mir-305
pte-mir-275Scf5bK3_1778: 109272-109339 [+]
pte-mir-305Scf5bK3_1778: 111273-111334 [+]
Database links

Mature sequence pte-miR-305-5p

Accession MIMAT0046154
Sequence

1 - 

uuuguacuucauuaggugcuc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pte-miR-305-3p

Accession MIMAT0046155
Sequence

40 - 

aggcaucuaagggagugcaaaug

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).